Skip to main content
Download PDF

Midgut immune profiling and functional characterization of Aedes aegypti ABC transporter gene(s) using systemic and local bacterial challenges

Parasites & Vectors volume 18, Article number: 34 (2025) Cite this article

Abstract

Background

The mosquito midgut is crucial for digestion and immune interactions. It produces several immune factors that protect the organ from invading pathogens and can limit their propagation. Studies on mosquito midgut transcriptome following pathogen exposure have revealed the presence of non-canonical immune genes, such as ABC transporters, whose function in insect immunity remains unexplored. Therefore, this study focuses on identifying and characterising the immune role of ABC transporters in the midgut of Aedes aegypti, a primary arboviral vector.

Methods

To identify the midgut-expressed ABC transporters, the mosquitoes were challenged with a mixture of gram-negative (Escherichia coli) and gram-positive (Micrococcus luteus) bacteria, and the expression of all ABC transporters was analysed with PCR using gene-specific primers. Furthermore, the transcriptional alterations of midgut ABC transporters were explored at different time points upon a thoracic nano-injection (systemic challenge) or infectious blood meal (local challenge) of the bacterial mixture through quantitative real-time PCR (qPCR), and one gene was selected for RNAi-mediated gene silencing and its role assessment in midgut immune responses.

Results

The expression of all 48 microbial-induced midgut-expressing Ae. aegypti ABC transporter genes upon systemic or local bacterial challenges was analyzed. Based on the transcriptomic data and potential immune expression similar to the well-known immune gene defensin, AaeABCG3 was selected for RNAi-mediated gene silencing and characterization. The AaeABCG3 gene silencing exhibited a significant reduction of midgut bacterial load through the induction of nitric oxide synthase (NOS) in sugar-fed and systemic bacterial-challenged mosquitoes. In contrast, midgut bacterial load was significantly regulated by induction of defensin A and cecropin G in the late hours of local bacterial challenges in AaeABCG3-silenced mosquitoes.

Conclusions

The silencing of AaeABCG3 modulated the mosquito midgut immune response and disturbed the midgut microbiota homeostasis. The systemic immune responses of AaeABCG3-silenced mosquitoes were influenced by the JAK-STAT pathway with no induction of Toll and IMD immune pathways. Interestingly, Toll and IMD immune pathways actively participated in the late hours of local bacterial challenges, suggesting that the route of infection influences these immune responses; however, the molecular mechanism behind these phenomena still needs to be explored. Overall, this work provides significant insight into the importance of ABC transporters in mosquito immunity.

Graphical Abstract

Background

Mosquitoes constantly face infection with various pathogens in their natural habitat and encounter several microorganisms during the aquatic developmental stages. Adults can be exposed to different microbes through nectar feeding and physical injuries. In addition, their haematophagous nature exposes them to microbes of the host skin and different blood-borne pathogens like dengue virus (DENV), Zika virus (ZIKV), and malaria parasite Plasmodium through blood-feeding [1, 2]. The mosquito midgut is the first organ to encounter and mount an array of immune responses against an ingested pathogen. In addition to being the organ of digestion, the mosquito midgut is also home to various naturally acquired microbiota required for digestion and nutrition [3, 4]. It is also a unique site for tripartite interactions among midgut microbiota, ingested pathogens, and mosquito innate immune systems. These reciprocal interactions could affect vector physiology and significantly impact immune responses [5, 6]. Therefore, the mosquito midgut is considered an organ of interest in controlling vector-borne diseases.

The immune signalling pathways like the Toll, immune deficiency (IMD), and Janus kinase signal transducer and activator of transcription (JAK-STAT) pathways are central to mosquito midgut innate immune response against invading pathogens [1, 7]. The Toll pathway is regulated by transcription factor Rel1 and tends to be induced against gram-positive bacteria, fungi, and viruses [1, 8,9,10], where it activates cellular immunity and increases the expression of the bactericidal peptides [9, 11, 12]. Its role against the dengue virus (DENV) has also been reported in Aedes aegypti [10]. The IMD pathway responses are controlled by the transcription factor Rel2 [1, 7]. This pathway is essential for controlling gram-negative and some gram-positive bacterial infections through the production of antimicrobial peptides (AMPs), where each AMP gene is reported to be expressed with different kinetics, suggesting that the transcription of AMP genes is a complex process [12,13,14,15].

The Toll and IMD pathways have overlapping molecules for eliciting an immune response. Interestingly, these pathways could co-regulate several AMPs, like defensins and cecropins. Defensins are the most effective antimicrobial peptides against gram-positive bacteria [7, 16, 17], while cecropins are predominantly responsive against gram-negative bacterial infection [18]. The reactive oxygen/nitrogen species (ROS/RNS) generation by dual oxidase enzyme (DUOX, an NADPH oxidase family member) or nitric oxide synthase (NOS, a downstream effector molecule of the JAK/STAT pathway) genes plays a crucial role in modulating the indigenous microbiota proliferation, opportunistic pathogenic bacterial growth, and arbovirual infection in the mosquito midgut [4, 19,20,21].

Recent studies in Anopheles stephensi, where mosquitoes were infected through bacterial feeding and bacterial microinjection, showed that tissues could synergistically cope with a local (endogenous) and systemic (exogenous) infection after microbial exposure, respectively [22]. The local immune defence largely relies on antimicrobial peptides (AMPs) produced by the immune signalling pathways and the physical barrier [6, 22, 23]. Bacterial challenges through thoracic injury cause induction of NOS in insect haemolymph, indicating the importance of ROS/RNS in systemic bacterial immune responses of the Anopheles gambiae mosquito [1, 24]. Recently, a transcriptional alteration of putative immune genes in the salivary gland of An. coluzzii was also reported upon local and systemic immune challenges [25]. The local and systemic immune responses and molecular communications between various organs/tissues have been well documented in insects like Drosophila and mosquitoes [22, 26].

Interestingly, some studies have shown that non-canonical immune molecules like ABC transporters exhibit transcriptomic alteration against microbial infections in mosquitoes [27]. The role of ABC transporters in insect immunity has also been reported in the fly and dengue virus vector in Ae. aegypti [28, 29], where they are commonly known for their role in insecticide or multidrug resistance. They contribute to insecticide detoxification by effluxing the intracellular concentration of toxic compounds or their metabolic products [28, 30,31,32]. In general, ABC transporters are the transmembrane molecular channels that utilise ATP hydrolysis energy to transport various molecules across the lipid bilayer. Typically, they consist of highly conserved nucleotide-binding domains (NBDs), which are located at the cytoplasmic side of the cell membrane, and less conserved transmembrane domains (TMDs) embedded into the lipid bilayer [33]. NBDs, also known as ATP-binding cassettes, contain various conserved signature motifs like Walker A (GXXGXGK(S/T)), Walker B (φφφφD, here φ denotes a hydrophobic residue), Q-loop, D-loop, and H-motif, as well as C-motif (LSGGQ), and hydrolyse ATP for transportation of various substrates. The transmembrane domains (TMDs) form the translocation pathway and provide specificity to a substrate [34, 35].

In this study, we have identified ABC transporter(s) expressed in the midgut upon bacterial challenges from Ae. aegypti for their immune characterisation. For this, we have used the catalogue of all 59 Ae. aegypti ABC transporter genes identified in our previous study [28]. Microbe-induced ABC transporters expressed in the midgut were identified post-systemic (thoracic injection of the mixture of gram-positive and -negative bacteria) and local (oral supplement of gram-positive and -negative bacterial mix) bacterial challenges using semiquantitative PCR with gene-specific primers. Furthermore, transcriptional alteration of the ABC transporter genes was examined using quantitative real-time PCR (qPCR) upon both systemic and local immune challenge at various time points. Based on the expression observed during the immune challenges and our previous report [28] where we observed downregulaion of AaeABCG3 in three arboviral infections, dengue, West Nile and yellow fever, ABC transporter AaeABCG3 gene was selected for further functional characterization using RNA interference (RNAi). AaeABCG3 gene silencing was observed to modulate the mosquito midgut immune responses, affecting the midgut microbiota homeostasis that regulate pathogen development in mosquitoes. Thus, the immune characterisation of the non-canonical molecules such as ABC transporters might offer new understandings to disrupt the transmission cycle of blood-borne pathogens [32].

Methods

Rearing of Ae. aegypti mosquitoes

Female Ae. aegypti mosquitoes (field-collected, molecular identified, and laboratory-reared mosquitoes from the Pilani region, Rajasthan, India) were reared in a semi-natural insectarium at 27 ± 1 °C, 80% relative humidity, and 12 h light/dark cycle as described before [28, 36, 37]. Larvae were fed on fish food (Gold Tokyo, Ahmedabad, India), while the adult mosquitoes were regularly fed on 10% sucrose solution ad libitum. Blood feeding was performed for colony propagation by allowing 4- to 5-day-old female mosquitoes to feed on anaesthetised mice. The mice were obtained from the Central Animal Facility of the Institute, and all the procedures were approved by the Institute Animal Ethics (IAEC/RES/28/7) and Institute Biosafety (BITS/IBSC/ 2018/02) Committees.

Designing of Ae. aegypti ABC transporter gene(s)-specific primers

cDNA sequences of all 59 Ae. aegypti ABC transporter genes (identified in our previous study [28]) were retrieved from VectorBase and subjected to BLASTn search against Ae. aegypti genome assembly 5 (AaegL5) to identify the unique regions for an individual ABC transporter. Primers were designed from these unique regions for individual ABC transporter genes using an online primer designing tool, primer3 (https://primer3.ut.ee/). During our in silico analysis, we observed an extensive duplication of some ABC transporter genes or gene segments like AaeABCA2 (AaeABCA2.1, AaeABCA2.2), AaeABCA7 (AaeABCA7.1, AaeABCA7.2) and AaeABCC4 (AaeABCC4.1, AaeABCC4.2) for which we designed common primers [28]. All primers were commercially synthesised from Integrated DNA Technologies (IDT), USA. Primers were also synthesised for Ae. aegypti transcription factor genes Rel1 (AAEL007696) and Rel2 (AAEL007624); effector genes defensin A (AAEL003841), cecropin G (AAEL015515), nitric oxide synthase (NOS) (AAEL009745), and dual oxidase enzyme (DUOX, AAEL007563); and housekeeping gene ribosomal protein S6 (RPS6) (AAEL000032). Primer sequences for all genes used in this study are provided in Supplementary Table 1.

Systemic and local immune challenges to Ae. aegypti mosquito

We obtained gram-negative Escherichia coli (MTCC, no. 40) and gram-positive Micrococcus luteus (MTCC no. 106) bacteria from Microbial Type Culture Collection, Institute of Microbial Technology (IMTECH) Chandigarh, India. The above two bacterial strains were grown individually in LB media broth following standard protocols [38] to an A600 = 0.5. A 1.5-ml aliquot from each culture was mixed and centrifuged for 5 min at 5000 rpm. The pellet was washed twice with 1× Ashburner’s PBS pH 7.2 (3 mM sodium chloride, 7 mM disodium hydrogen phosphate, and 3 mM sodium dihydrogen phosphate) and resuspended in 1× Ashburner’s PBS.

For systemic infection, the above mixture of bacteria (live or heat-killed) was injected into the haemocoel of mosquitoes using Nanojector injection system (Drummond, Broomall, PA, USA), as detailed before [38, 39]. The heat-killed bacteria (immune elicitors) were prepared by boiling the bacterial mixture for 5 min, as described before [38], and administered similarly to the live bacterial challenge. Uninjected and sterile PBS-injected mosquitoes served as a control in the experiment. Local infection was introduced to Ae. aegypti adult female mosquitoes by allowing them to feed on mousee blood supplemented with or without bacterial suspension through an artificial membrane feeder. For this, the bacterial preparation was resuspended in 3 ml heparinised mouse blood to make the final concentration of 109cells/ml (finally 0.5 × 109 cells of each bacterium per ml blood) as before [4, 38]. After the bacterial challenge, the midgut and carcass tissues were collected from control and infected females at different time points. Uninfected midguts and carcasses served as controls. The schematics of the experimental setup are shown in Fig. 1.

Fig. 1
figure 1

Schematics summary of mosquito immune challenge and profiling: Schematic representation for identification and selection of midgut-expressing Aedes aegypti ABC transporter genes through semi-quantitative PCR and qPCR upon bacterial challenge. This figure was created with BioRender.com

Full size image

RNA isolation, cDNA preparation, and quantitative PCR

Total RNA was isolated from midgut and carcass samples using RNAeasy mini kit (Qiagen, Hilden, Germany) with a slight modification of adding 30 μl β-mercaptoethanol/ml RLT buffer.

First-strand cDNA was synthesised using QuantiTect reverse transcription kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions, followed by semi-quantitative PCR using gene-specific primers. Primer sequences of all genes analysed during this study are mentioned in Supplementary Table 1. The midgut expressing ABC transporter genes were further analysed by qPCR using SYBR green supermix in an iQTM5 multicolor detection system (Bio-Rad, Hercules, CA, USA), where the mRNA for mosquito ribosomal protein subunit S6 gene was used as a normalisation control [37]. The following PCR cycle parameters were used: initial denaturation at 95 °C for 3 min, 35 cycles of 10 s at 95 °C, 40 s at 55 °C, and 1 min at 72 °C. The fluorescence readings were taken after each cycle. A final extension at 72 °C for 10 min was performed, followed by a melting curve analysis. Fold changes were calculated using the ΔΔCt method as described before [40]. Based on the expression analysis, the ABC transporter gene of Subfamily G (AaeABCG3) was shortlisted for gene silencing and further analysis.

dsRNA synthesis of control and target genes

A 218-bp fragment of the lacZ gene (control) was amplified using the primers (5′ to 3′) F-GAGTCAGTGAGCGAGGAAGC and R-TATCCGCTCACAATTCCACA and cloned into the pCRII-TOPO vector [38]. To prepare dsRNA of AaeABCG3 (target gene), a 240-bp fragment of the gene was cloned in pCRII-TOPO vector that already had a T7 promoter site at the M13F end. T7 promoter at the other end of the fragment was incorporated by amplifying the cloned insert using the following primers: M13F-GTAAAACGACGGCCAGT and T7-M13R-CTCGAGTAATACGACTCACTATAGGGCAGGAAACAGCTATGAC. PCR amplification was carried out at 95 °C for 5 min, followed by 40 cycles at 95 °C for 30 s, 55 °C for 30 s, 72 °C for 30 s, and a final extension at 72 °C for 10 min. Amplicons were purified from the gel using the QIAquick Gel Extraction Kit (Qiagen, Valencia, CA, USA). To synthesise dsRNA, these purified amplicons tailed with T7 promoter sequences were subjected to in vitro transcription using the MEGAscript kit (Ambion, Austin). The synthesised dsRNA was further purified using a Microcon YM-100 filter (Millipore, Germany) and finally concentrated to 3 µg/µl in DNase and RNase-free water.

Effect of target gene silencing on midgut bacteria

One–two-day-old female Ae. aegypti mosquitoes were injected with 69 nl of 3 µg/µl dsRNA of AaeABCG3 (207 ng/mosquito) into their thorax using a nanojector (Drummond, Broomall, PA, USA). Control mosquitoes were injected with LacZ dsRNA in the same manner. Four days after injection, the efficiency of mosquito AaeABCG3 silencing was analysed using the expression primers (5′ to 3′) Fw – CCGGCTTCTTCGTCAACTTC and Rev – CAGAC CGATGAACAGGCAAA. After successful AaeABCG3 silencing, samples were collected from both control and AaeABCG3-silenced mosquitoes (sugar-fed without any immune challenges) to assess the gene-silencing impact on endogenous midgut bacteria and immunity.

Post-AaeABCG3 silencing, mosquitoes were either allowed to feed on a mouse blood-supplemented bacterial mixture (local immune challenge) or a bacterial mixture was injected into the haemocoel (systemic immune challenge), as mentioned in Section “Systemic and local immune challenges to Ae. aegypti mosquito”. The impacts of AaeABCG3 silencing on midgut bacteria and immunity were calculated by qPCR using 16S rRNA and immune gene-specific primers, respectively. Midgut samples were collected at early and late hours of bacterial immune challenges based on the results obtained from systemic and local immune challenges, as shown in Fig. 2.

Fig. 2
figure 2

Schematics for RNAi-mediated functional characterisation of the target ABC transporter gene upon systemic and local immune challenges. (Created with BioRender.com)

Full size image

RNA was isolated from these samples and used to synthesise first-strand cDNA, as mentioned in section “RNA isolation, cDNA preparation, and quantitative pcr". This was followed by qPCR for various ABC transporter genes using SYBR green supermix in an iQTM5 multicolour detection system (Bio-Rad, Hercules, CA, USA). Aedes aegypti ribosomal protein subunit S6 gene was used as a normalisation control [37]. Fold changes were calculated using the ΔΔCt method as described before [40].

Statistical analysis

All the data were expressed as mean ± standard deviation (SD). Statistical significance between the test and their controls was analysed using GraphPad Prism 8.0, a statistical software package (GraphPad Software, La Jolla, CA, USA). The type of test applied in the analysis is detailed in its respective figure legend. The data with a p-value < 0.05 were considered significant and indicated with asterisks (*p < 0.05; **p < 0.01; ***p < 0.001; ****p < 0.0001; ns = not significant).

Results

Identification of ABC transporter genes in Ae. aegypti midgut upon immune challenges

The organ-specific microbial-induced ABC transporter genes of Ae. aegypti were identified by challenging the mosquitoes with a mixture of gram-positive (E. coli) and gram-negative bacteria (M. luteus) using local and systemic routes (Fig. 1A). On monitoring the survival rate of mosquitoes for 7 days post immune challenges, we observed ≈100% survival in the case of local immune challenge, while the survival rate reduced to 50–60% during the systemic challenge.

To analyse the expression of ABC transporters in the midgut (Mg) and carcass (Cc), we amplified all 59 ABC transporters [28] using semi-quantitative PCR (Fig. 3i). Overall, 48 ABC transporter genes were expressed in the immune-challenged midgut of Ae. aegypti, of which only a few were expressed exclusively in the midgut, as depicted in Fig. 3ii, iii.

Fig. 3
figure 3

Tissue specific identification of ABC transporters upon bacterial immune challenges: i Identification and selection of midgut-expressing Aedes aegypti ABC transporter genes through semi-quantitative PCR post bacterial challenges. ii Expression profile of ABC transporter genes exclusive to the midgut or carcass (depicted in the mosquito cartoon). This figure was created with BioRender.com. iii Expression status of Ae. aegypti ABC transporter genes in the midgut, carcass or both tissues post bacterial challenges. M, marker; MG, midgut and CC, carcass

Full size image

Systemic immune challenge induces transcriptional alteration of AMPs and ABC transporter genes in the midgut of Ae. aegypti

Live bacterial challenge (systemic immune challenge)

The systemic immune challenge with live bacteria exhibited an early induction of the mosquito midgut immunity where defensin A (Fig. 4A) and cecropin G (Fig. 4B) showed ~ 20- and 40-fold upregulation at 1-h post bacterial challenge (hpc), respectively. Furthermore, these immune genes showed an increase in expression until 12 hpc (Fig. 4A and B). Similar transcriptional alterations were also observed for a few other ABC transporter genes post-live bacterial challenge (systemic immune challenge) in Ae. aegypti midgut (Fig. 4C).

Fig. 4
figure 4

Expression analysis of AMPs and ABC transporter genes post-live bacterial (systemic) challenge. A Relative fold change expression of defensin A, B cecropin G, and C midgut-expressing Aedes aegypti ABC transporter genes by qPCR at various time points post-bacterial challenge. All samples were collected from three biological replicates (n = 10 per replicate) for each treatment (systemic immune challenged v/s sham-treated controls) at 1-, 3-, 6-, 9-, and 12 hpc. Statistical significance was analysed by one-way ANOVA with Tukey’s multiple comparison test for the differential gene expression using GraphPad Prism 8.0 (GraphPad Software, La Jolla, CA, USA). Significant differences among relative mRNA expression are represented with letters like “a, b, c”. The colour scheme indicates the log2 fold change in mRNA expression of ABC transporter genes

Full size image

Most members of AaeABCA and AaeABCB subfamilies exhibited upregulation at various time points, where AaeABCA2, AaeABCA4, AaeABCA10, and AaeABCB2 exhibited continuous upregulation. In addition, upregulation was also observed for AaeABCG3 and AaeABCG15 at various time points. In contrast, most members of AaeABCD, AaeABCG, and AaeABCH subfamilies exhibited downregulation post-live bacterial challenge, where AaeABCD1, AaeABCG11, AaeABCG13, AaeABCG18, AaeABCG21, and AaeABCH3 were observed to be downregulated throughout the infection. Basal to reduced expression was observed for the AaeABCE subfamily, while AaeABCF subfamily members exhibit upregulation during the early hours of live bacterial challenge. AaeABCC subfamily members showed mixed responses where AaeABCC3, AaeABCC6, and AaeABCC9 were downregulated at 6 hpc but exhibited upregulation at 12 hpc (Fig. 4C).

Heat-killed bacterial challenge (systemic immune challenge)

Heat-killed bacterial challenge induced an early increase in the transcription of AMPs (Fig. 5A, B) and midgut-specific ABC transporter genes compared to the live bacterial challenge (Fig. 5C). The members of AaeABCA and AaeABCC subfamilies displayed varied expressions at various time points post-heat-killed bacterial challenges. AaeABCA1 and AaeABCA10 exhibited continuous upregulation, while AaeABCA4 and AaeABCA6 showed constant downregulation. In the AaeABCC subfamily, AaeABCC3, AaeABCC4, AaeABCC7 and AaeABCC12 exhibited continuous upregulation, while AaeABCC1, AaeABCC2, and AaeABCC14 were downregulated. Most members of AaeABCB, AaeABCD, AaeABCE, and AaeABCF subfamilies exhibited basal to reduced expression, suggesting their minimal role in mosquito immunity. In contrast, the AaeABCG and AaeABCH subfamilies members exhibited maximum upregulation at 6 hpc, slightly earlier than the live bacterial challenge (Fig. 5C).

Fig. 5
figure 5

Expression analysis of AMPs and ABC transporter genes post-heat-killed bacterial (systemic) challenge to Aedes aegypti. A Relative fold change expression of defensin A, B cecropin G, and C midgut-expressing Ae. aegypti ABC transporter genes by qPCR at various time points post-nano-injection of the heat-killed bacterial mix. All samples were collected from three biological replicates (n = 10 per replicate) of each treatment (systemic immune challenged v/s control mosquitoes). Statistical significance was analysed by one-way ANOVA (GraphPad Software, La Jolla, CA, USA). Significant differences among relative mRNA levels are represented with letters like “a, b, c”. The colour scheme indicates the log2 fold change in mRNA expression of ABC transporter genes

Full size image

Both live and heat-killed bacterial challenges (systemic immune challenges) induced transcriptional alteration of AMPs and ABC transporter genes in the midgut of Ae. aegypti (Figs. 4 and 5). While the live bacterial challenge exhibited a higher level of expression of AMPs and upregulation of many midgut-specific ABC transporter genes (Fig. 4), the heat-killed bacterial challenge showed just a notable early transcriptional increase of AMPs and upregulation of only a few midgut-specific ABC transporter genes, with maximum expression till 6 hpc, after which it started to decline (Fig. 5).

Local immune challenges induce late transcriptional activation of mosquito immune and ABC transporter genes

Local immune challenges were introduced by artificial feeding of a gram-positive and gram-negative bacterial mixture to the female Ae. aegypti and the expression of AMPs and ABC transporters were analysed by qPCR (Fig. 6A, B). Only those genes that showed similar and contrasting expression profiles during systemic immune challenges (live and heat-killed bacteria challenges) were selected and investigated for their role in local immune response (Fig. 6).

Fig. 6
figure 6

Expression profiling of antimicrobial peptides and ABC transporter genes upon local immune challenges. Relative fold change expression of A defensin A, B cecropin G, and C midgut-expressing Aedes aegypti ABC transporter genes by qPCR at various time points post-bacterial supplemented blood-feeding (local immune challenge). All samples were collected from three biological replicates (n = 10 per replicate) of each treatment (local immune-challenged test vs. control mosquitoes) at 3-, 6-, 9-, 18-, and 24 hpc. Statistical significance was analysed by one-way ANOVA with Tukey’s multiple comparison test for the differential gene expression using GraphPad Prism 8.0 (GraphPad Software, La Jolla, CA, USA). Significant differences among relative mRNA levels are represented with letters like “a, b, c”

Full size image

A delayed immune response was observed, and the genes defensin A and cecropin G showed late induction with maximum expression at 24 hpc (Fig. 6A, B). Furthermore, we investigated the expression levels of the selected ABC transporter genes post-bacteria-supplemented blood-feeding (local immune challenge). Similar to defensin A and cecropin G, AaeABCF2 and AaeABCG3 also showed upregulation at 24 hpc. However, AaeABCC13 and AaeABCC14 showed downregulation throughout the local immune challenge (Fig. 6C). It is important to note that the systemic immune challenge of live bacteria exhibited constant upregulation of AaeABCC14 (Fig. 4C). However, downregulation of this gene was observed post-heat-killed bacterial challenge (Fig. 5C).

Furthermore, to elucidate the role of ABC transporters in immunity, we analysed the expression profile of the ABC transporters in systemic and local immune challenges and selected a candidate gene, AaeABCG3, for further characterisation and to investigate its role in mosquito midgut immunity.

Functional characterisation of AaeABCG3 upon immune challenge through RNAi-mediated gene silencing

To characterise the AaeABCG3 gene, the dsRNA of AaeABCG3 (target) and LacZ (control) was injected into a group of mosquitoes (test and control group) as depicted in Fig. 2. The AMP (especially defensin A) induction represented two episodes, an early phase expression around 1 to 6 hpc and a late phase induction around 12 to 24 hpc. The gene-silenced and control midguts were collected at these two indicative time points to analyse the target and immune genes expression profile (as discussed in materials and methods) against bacterial immune challenges.

Silencing of AaeABCG3 gene suppresses the native midgut bacteria by reactive species generation

To illustrate the possible role of AaeABCG3 in native midgut bacterial homeostasis, the expression of AaeABCG3 gene in sugar-fed midguts of AaeABCG3 gene-silenced mosquitoes was analysed against dsLacZ control mosquitoes. Expression analysis 4 days post-injection revealed a significant reduction in AaeABCG3 mRNA levels in gene-silenced mosquito midguts compared to dsLacZ controls (Fig. 7A). Furthermore, we evaluated the gene-silencing effect on the growth of endogenous bacteria in the silenced midguts by analysing 16S rRNA levels (Fig. 7B). A significant (~ 1.5 fold) downregulation of 16S rRNA levels in the silenced midguts against sham-treated controls was observed.

Fig. 7
figure 7

Effect of AaeABCG3 gene silencing on endogenous bacteria and genes responsible for reactive species generation in midgut of sugar fed mosquitoes: Relative mRNA expression of A AaeABCG3, B 16S rRNA, C DUOX, and D NOS in AaeABCG3-silenced Aedes aegypti midguts (dsAaeABCG3, n = 10) compared to sham-treated controls (dsLacZ, n = 10) at 0 h of 4 days post-injection of dsRNA. Statistical significance was analysed by multiple t-tests with the Holm-Sidak method for the differential gene expression using GraphPad Prism 8.0 (GraphPad Software, La Jolla, CA, USA)

Full size image

These results prompted us to explore the immune regulations behind the endogenous bacterial suppression in AaeABCG3-silenced midguts. Therefore, we evaluated the expression of some well-known genes responsible for reactive oxygen/nitrogen species (ROS/RNS) like DUOX and NOS. We observed an increase of ≈1.8 and 1.3 fold in the DUOX and NOS mRNA levels respectively in the silenced sugar-fed midguts compared to the controls (Fig. 7C, D).

We further analysed the expression of Rel1 and Rel2 transcription factors of immune pathways and their immune effectors AMP genes, such as defensin A and cecropin G, in the silenced midguts against sham-treated controls (Fig. 8). We observed no change in the expression of Rel1 (Fig. 8A). At the same time, Rel2 exhibited significant downregulation in silenced midguts against sham-treated controls (Fig. 8B). A significant downregulation in defensin A and cecropin G expression (2.4 and 14.3 fold, respectively) was observed in AaeABCG3-silenced midguts compared to the controls (Fig. 8C, D).

Fig. 8
figure 8

AaeABCG3-silenced mosquitoes exhibit suppressed immunity in sugar-fed midguts. Relative mRNA expression of A Rel1, B Rel2, C defensin A, and D cecropin G in AaeABCG3-silenced Aedes aegypti midguts (dsAaeABCG3, n = 10) compared to sham-treated controls (dsLacZ, n = 10) at 0 h of 4 days post-injection of dsRNA. Statistical significance was analysed by multiple t-tests with the Holm-Sidak method for the differential gene expression using GraphPad Prism 8.0 (GraphPad Software, La Jolla, CA, USA)

Full size image

Silencing of AaeABCG3 gene modulates the midgut bacterial load during systemic bacterial challenge

To further understand the impact of AaeABCG3 gene silencing on midgut immune regulation upon systemic bacterial challenge, the mosquitoes were injected with a bacterial mixture post-4-days of silencing, and the midgut samples were collected, as discussed in Fig. 2. The AaeABCG3 expression in gene-silenced midguts was compared to sham-treated controls, revealing a significant silencing level of AaeABCG3 (Fig. 9A).

Fig. 9
figure 9

Effect of AaeABCG3 gene silencing on midgut bacterial load and genes related to reactive species generation post-systemic bacterial challenge. Relative mRNA expression of A AaeABCG3, B 16S rRNA, C DUOX, and D NOS in AaeABCG3-silenced midguts compared to sham-treated controls post-systemic immune challenge. Statistical significance was analysed by multiple t-tests with the Holm-Sidak method for the differential gene expression using GraphPad Prism 8.0 (GraphPad Software, La Jolla, CA, USA)

Full size image

Furthermore, we evaluated the impact of the systemic immune challenge on the midgut bacterial load at early (6 hpc) and late (12 hpc) time points by analysing 16S rRNA levels. Initially, the bacterial levels decreased by 3.85 fold; however, they increased to 4.76 fold later in the silenced midguts against sham-treated controls (Fig. 9B). We observed the induction of DUOX in the early and late hours of systemic bacterial challenge in AaeABCG3-silenced midguts compared to sham-treated controls (Fig. 9C).

We further analysed the expression of NOS in controls and AaeABCG3-silenced midguts upon the systemic bacterial challenge to understand the involvement of the JAK-STAT pathway in antibacterial immunity. We observed 1.7-fold induction for NOS in the early hours of systemic immune challenge (Fig. 9D), corroborating the reduction in midgut bacterial load in AaeABCG3-silenced midguts compared to sham-treated controls (Fig. 9B). However, a 1.26-fold reduction in the expression of NOS was observed in the late hours of the systemic immune challenge (Fig. 9D), which also corroborates the increase in midgut bacterial load in silenced midguts against sham-treated controls (Fig. 9B).

To further understand the role of AMPs in AaeABCG3-silenced midgut upon systemic immune challenge, we analysed the expression profile of defensin A and cecropin G and their transcription factors Rel1 and Rel2 in the above samples. We observed significant downregulation of Rel 1 and Rel 2 in AaeABCG3-silenced midguts at early time points compared to their respective controls (Fig. 10A, B). In addition, the mRNA expression of the classical immune genes defensin A and cecropin G was significantly reduced in AaeABCG3-silenced midguts at both early and late time points compared to their respective controls (Fig. 10C, D), as observed previously for the sugar-fed ABCG3-silenced midguts (Fig. 8C, D).

Fig. 10
figure 10

AaeABCG3-silenced mosquitoes exhibit suppressed immunity in systemic bacterial-challenged midguts. Relative mRNA expression of the transcription factors A Rel1, B Rel2 and their immune effector genes, C defensin A, and D cecropin G in AaeABCG3-silenced midguts compared to sham-treated controls post-systemic immune challenge was assessed through qPCR using gene-specific primers. Statistical significance was analysed by multiple t-tests with the Holm-Sidak method for the differential gene expression using GraphPad Prism 8.0 (GraphPad Software, La Jolla, CA, USA)

Full size image

Silencing of AaeABCG3 suppresses the proliferation of bacteria in the midgut upon local immune challenge

To understand the regulation of immunity upon local immune challenges in the AaeABCG3-silenced midguts, the mosquitoes were allowed to feed on the bacteria-supplemented blood meal post-4 days of dsRNA injection, as depicted in Fig. 2. The midgut samples were collected during the early (6 hpc) and late hours (24 hpc) of local immune challenges. We observed a significant reduction in mRNA levels of AaeABCG3 in silenced midguts compared to the sham-treated controls (Fig. 11A). Furthermore, we evaluated the impact of the local immune challenge on the midgut bacteria by analysing 16S rRNA levels, which exhibited a 1.81-fold increase in midgut bacterial load at early stages of local immune challenges; however, at the late stage of local immune challenges, the bacterial load significantly decreased by 4.96 fold in the silenced midguts against sham-treated controls (Fig. 11B). Thus, the silencing of AaeABCG3 reduced the overall proliferation of the bacteria in the midgut bolus, which might include endogenous and exogenous bacteria.

Fig. 11 
figure 11

Effect of AaeABCG3 gene silencing on midgut bacterial load and genes related to reactive species generation upon local immune challenge. Relative expression of A AaeABCG3 mRNA, B 16S rRNA, C DUOX, and D NOS mRNA in local immune-challenged AaeABCG3-silenced midguts. Statistical significance was analysed by multiple t-tests with the Holm-Sidak method for the differential gene expression using GraphPad Prism 8.0 (GraphPad Software, La Jolla, CA, USA)

Full size image

We further investigated the expression of the DUOX and NOS genes to understand the involvement of reactive species in antibacterial immunity in AaeABCG3-silenced midguts against controls upon local immune challenge. We observed a significant downregulation of the DUOX gene in the early hours. In contrast, this gene exhibits upregulation in the late hours of the local immune challenges against sham-treated controls (Fig. 11C). However, we observed a significant downregulation of the NOS gene at the early and late hours of the local immune challenges (4.64 and 2.78 fold, respectively) against sham-treated controls (Fig. 11D).

Furthermore, when we analysed the expression of AMPs and their transcription factors, we observed significant upregulation of Rel1 and Rel2 in the late hours of local immune-challenged AaeABCG3-silenced midguts against their respective sham-treated controls (Fig. 12A, B). Both defensin A and cecropin G genes were significantly downregulated in the early hours of the local immune challenge, which might help the midgut bacterial propagation (Fig. 11B). However, at the late hours of the local immune challenge, defensin A and cecropin G were significantly upregulated (Figs. 12C, D), leading to the suppression of midgut bacteria, which is also evident by significant downregulation of 16S rRNA expression (Fig. 11B).

Fig. 12
figure 12

AaeABCG3 gene-silenced mosquito exhibits elevated midgut immunity during the late hours of local bacterial challenge. Relative mRNA expression of A Rel1, B Rel2, C defensin A, and D cecropin G in AaeABCG3-silenced midguts compared to sham-treated controls post-bacterial supplemented feeding (local immune challenge). Statistical significance was analysed by multiple t-tests with the Holm-Sidak method for the differential gene expression using GraphPad Prism 8.0

Full size image

Discussion

The mosquito midgut is essential for acquiring nutrition, immunity, and female fecundity due to the digestion of blood meal. It is an admirable system to understand the interaction of innate immunity, natural microbial habitats, and exogenous non-infectious or infectious meals. It is a critical organ that determines the vector competence for ingested pathogens [4, 41]. Most immune responses to various infections rely on activating immune signalling pathways by producing AMPs and reactive oxygen and nitrogen intermediates [1, 22, 42]. The midgut epithelial cells have been reported to be involved directly in innate immunity and can also perform inter-organ communication with the fat bodies and haemocytes [22]. Thus, to analyse the impact of ABC transporter on immunity, we initiated our experiments by identifying microbe-induced ABC transporter genes expressed in Ae. aegypti midgut post local and systemic bacterial challenges.

We identified expression for 48 Ae. aegypti ABC transporter genes following semi-quantitative PCR; however, for a few members of subfamilies AaeABCA (AaeABCA8 and AaeABCA9), AaeABCC (AaeABCC5), and AaeABCG (AaeABCG1, AaeABCG2, AaeABCG4, AaeABCG5, and AaeABCG19/G20), no expression was detected post-immune challenges. The literature survey and existing data analysis suggested that the undetected genes such as AaeABCA8 and AaeABCA9 might be involved in mosquito host-seeking behaviour or development as these were highly expressed in Ae. aegypti brain and sensory organs like antennae, legs, proboscis, and palps [43]. The uninduced ABC transporter genes included members of AaeABCG subfamily that are related to eye pigment transportation, like white (AaeABCG1), scarlet (AaeABCG2 and AaeABCG4), and brown (AaeABCG5). These genes are expressed during various developmental stages of mosquitoes, emphasising their exclusive role in insect eye pigmentation [28, 44, 45].

Furthermore, we investigated the transcriptional expression of microbial-induced midgut-expressing Ae. aegypti ABC transporter genes upon both systemic (intrathoracic microinjections) and local (infectious meal) immune challenges (Figs. 4–6). We observed early immune response to the systemic immune challenges, as reported previously [22], where both known AMPs exhibited early induction. In addition, we also observed early induction of some ABC transporters from subfamily AaeABCA, AaeABCB, and AaeABCG. During local immune challenges, our results exhibited downregulation of classical AMPs, defensin A and cecropin G, shortly after an infectious blood meal, which increased significantly at the later time point. This supports the recent report demonstrating the role of local immunity in the defence against ingested pathogens in mosquitoes [22]. Similar to the expression of AMPs, we also observed initial downregulation of AaeABCF2 and AaeABCG3, which have increased lately, suggesting their possible involvement in a late local immune response (Fig. 6). All these observations relate to previous reports stating the importance of balancing immunity with tolerance to protect midgut microbiota from mosquito immunity [46].

Based on the observations made through systemic and local immune challenges and following the similar expression profile compared to classical immune gene defensin, we selected AaeABCG3 gene from the pool of genes exhibiting modulation post-bacterial challenges for further analysis. RNAi-mediated gene silencing of AaeABCG3 in the sugar-fed mosquitoes revealed significant downregulation of the 16S rRNA level, suggesting its potential role in maintaining endogenous bacterial homeostasis in mosquito midguts.

As per recent reports, the route of infection significantly impacts mosquito immunity against exogenous bacteria [47, 48]. Thus, we further explored AaeABCG3 silencing’s impact on mosquito midgut immune regulation upon the exogenous bacterial immune challenge administered through the systemic and local routes and observed a significant decrease in expression of defensin A and cecropin G in AaeABCG3 silenced midgut against sham-treated control mosquitoes upon both systemic and local (only early hpc) bacterial challenges, which suggested downregulation of the classical Toll and/or Imd immune pathways. However, the reduction in midgut bacterial load did not correlate with the downregulation of AMPs. In addition, the downregulation of AMPs in the gene-silenced mosquitoes was in contrast to the general systemic immune response where the AMPs showed an early response, suggesting that AaeABCG3 silencing somehow suppressed the vector classical innate pathways during exogenous bacterial infection.

Further analysis revealed an overall corroboration in DUOX and NOS levels in AaeABCG3 gene-silenced sugar-fed and systemically bacterial-challenged mosquitoes, with 16S rRNA expression (bacterial load), suggesting the possible involvement of JAK-STAT immune pathway in AaeABCG3-silenced mosquitoes. Our results parallel earlier reports, suggesting that the reactive species are continuously present in the midgut of sugar-fed mosquitoes [20]. It also suggests that blood feeding suppresses reactive species generation in the mosquito midgut [20]. This coincides with our results for local immune challenges where the downregulation of the DUOX (early hours) and NOS gene was observed in AaeABCG3 gene-silenced mosquitoes against the sham-treated controls. However, an increase in the classical immune genes defensin A and cecropin G during late hours of local immune challenges in the gene-silenced mosquitoes compared to sham-treated controls suggests that the mosquito midgut immunity recuperates via the Toll or Imd pathways to maintain midgut bacterial homeostasis. These findings parallel previous reports, indicating that the midgut has an extraordinary ability to manage midgut microbiota homeostasis to avoid the deleterious effects of increased bacterial load on mosquitoes [4, 20, 38, 49,50,51]. Cumulatively, these findings support earlier reports suggesting that, in mosquitoes, blood-feeding induces formation of the peritrophic membrane, which acts as a barrier between ingested pathogens and midgut immunity [4, 52, 53]. However, when there is an increase in the bacterial load in late hours, the midgut displays an immune response by inducing expression of AMPs like cecropin G to maintain midgut homeostasis.

Conclusions

This work reports molecular evidence for the connection between different immune stimulations and the transcriptional regulation of the midgut-specific ABC transporter genes. One of the ABC transporter genes, AaeABCG3, was funcionally characterized using RNAi-mediated gene silencing where it was seen to play a potential role in mosquito immunity. Notably, we have also found some other ABC transporter genes whose expression was significantly modulated during the systemic and local immune challenges. Further functional analyses of these ABC transporter genes will be desirable to elucidate their effective involvement in midgut immune activity. We believe that the work reported here provides useful indications in this direction.

 Data Availability Statement: 

The data used for this study is already available in the main text.

References

  1. Hillyer JF. Mosquito immunity. Adv Exp Med Biol. 2010;708:218–38. https://doiorg.publicaciones.saludcastillayleon.es/10.1007/978-1-4419-8059-5_12.

    Article  CAS  PubMed  Google Scholar 

  2. Sim S, Jupatanakul N, Dimopoulos G. Mosquito immunity against arboviruses. Viruses. 2014;6:4479–504. https://doiorg.publicaciones.saludcastillayleon.es/10.3390/v6114479.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  3. Coon KL, Vogel KJ, Brown MR, Strand MR. Mosquitoes rely on their gut microbiota for development. Mol Ecol. 2014;23:2727–39. https://doiorg.publicaciones.saludcastillayleon.es/10.1111/mec.12771.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  4. Kajla M, Choudhury TP, Kakani P, Gupta K, Dhawan R, Gupta L, et al. Silencing of Anopheles stephensi heme peroxidase HPX15 activates diverse immune pathways to regulate the growth of midgut bacteria. Front Microbiol. 2016;7:1351. https://doiorg.publicaciones.saludcastillayleon.es/10.3389/fmicb.2016.01351.

    Article  PubMed  PubMed Central  Google Scholar 

  5. Dennison NJ, Jupatanakul N, Dimopoulos G. The mosquito microbiota influences vector competence for human pathogens. Curr Opin Insect Sci. 2014;3:6–13. https://doiorg.publicaciones.saludcastillayleon.es/10.1016/j.cois.2014.07.004.

    Article  PubMed  PubMed Central  Google Scholar 

  6. Ramirez JL, Souza-Neto J, Cosme RT, Rovira J, Ortiz A, Pascale JM, et al. Reciprocal tripartite interactions between the Aedes aegypti midgut microbiota, innate immune system and dengue virus influences vector competence. PLoS Negl Trop Dis. 2012;6:e1561. https://doiorg.publicaciones.saludcastillayleon.es/10.1371/journal.pntd.0001561.

    Article  PubMed  PubMed Central  Google Scholar 

  7. Kumar A, Srivastava P, Sirisena P, Dubey S, Kumar R, Shrinet J, et al. Mosquito innate immunity. Insects. 2018;9:95. https://doiorg.publicaciones.saludcastillayleon.es/10.3390/insects9030095.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  8. Lemaitre B, Nicolas E, Michaut L, Reichhart JM, Hoffmann JA. The dorsoventral regulatory gene cassette spatzle/Toll/Cactus controls the potent antifungal response in Drosophila adults. Cell. 1996;86:973–83. https://doiorg.publicaciones.saludcastillayleon.es/10.1016/s0092-8674(00)80172-5.

    Article  CAS  PubMed  Google Scholar 

  9. Michel T, Reichhart J-M, Hoffmann JA, Royet J. Drosophila Toll is activated by Gram-positive bacteria through a circulating peptidoglycan recognition protein. Nature. 2001;414:756–9. https://doiorg.publicaciones.saludcastillayleon.es/10.1038/414756a.

    Article  CAS  PubMed  Google Scholar 

  10. Xi Z, Ramirez JL, Dimopoulos G. The Aedes aegypti toll pathway controls dengue virus infection. PLoS Pathog. 2008;4:1000098.

    Article  Google Scholar 

  11. Gottar M, Gobert V, Michel T, Belvin M, Duyk G, Hoffmann JA, et al. The Drosophila immune response against Gram-negative bacteria is mediated by a peptidoglycan recognition protein. Nature. 2002;416:640–4.

    Article  CAS  PubMed  Google Scholar 

  12. Lemaitre B, Kromer-Metzger E, Michaut L, Nicolas E, Meister M, Georgel P, et al. A recessive mutation, immune deficiency (imd), defines two distinct control pathways in the Drosophila host defense. Proc Natl Acad Sci. 1995;92:9465–9.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  13. Avadhanula V, Weasner BP, Hardy GG, Kumar JP, Hardy RW. A novel system for the launch of alphavirus RNA synthesis reveals a role for the imd pathway in arthropod antiviral response. PLoS Pathog. 2009;5:e1000582.

    Article  PubMed  PubMed Central  Google Scholar 

  14. Barletta ABF, Nascimento-Silva MCL, Talyuli OAC, Oliveira JHM, Pereira LOR, Oliveira PL, et al. Microbiota activates IMD pathway and limits Sindbis infection in Aedes aegypti. Parasites Vectors. 2017;10:1.

    Article  Google Scholar 

  15. Zhang R, Zhu Y, Pang X, Xiao X, Zhang R, Cheng G. Regulation of antimicrobial peptides in Aedes aegypti Aag2 cells. Front Cell Infect Microbiol. 2017;7:22.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  16. De Gregorio E. The Toll and Imd pathways are the major regulators of the immune response in Drosophila. EMBO J. 2002;21:2568–79.

    Article  PubMed  PubMed Central  Google Scholar 

  17. Tzou P, Reichhart JM, Lemaitre B. Constitutive expression of a single antimicrobial peptide can restore wild-type resistance to infection in immunodeficient Drosophila mutants. Proc Natl Acad Sci USA. 2002;99:2152.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  18. Imler J-L, Bulet P. Antimicrobial peptides in Drosophila: structures, activities and gene regulation. In: Kabelitz D, Schröder JM, editors. Mechanisms of epithelial defense. Basel: Karger; 2005. p. 1–21.

    Google Scholar 

  19. Ha EM, Lee KA, Seo YY, Kim SH, Lim JH, Oh BH, et al. Coordination of multiple dual oxidase-regulatory pathways in responses to commensal and infectious microbes in Drosophila gut. Nat Immunol. 2009;10:949–57.

    Article  CAS  PubMed  Google Scholar 

  20. Oliveira JHM, Gonçalves RLS, Lara FA, Dias FA, Gandara ACP, Menna-Barreto RFS, et al. Blood meal-derived heme decreases ROS levels in the midgut of Aedes aegypti and allows proliferation of intestinal microbiota. PLoS Pathog. 2011;7:e1001320.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  21. Liu J, Liu Y, Nie K, Du S, Qiu J, Pang X, et al. Flavivirus NS1 protein in infected host sera enhances viral acquisition by mosquitoes. Nat Microbiol. 2016;1:16087.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  22. De Das T, Sharma P, Thomas T, Singla D, Tevatiya S, Kumari S, et al. Interorgan molecular communication strategies of “local” and “systemic” innate immune responses in mosquito Anopheles stephensi. Front Immunol. 2018;9:148.

    Article  Google Scholar 

  23. Bartholomay LC, Michel K. Mosquito immunobiology: the intersection of vector health and vector competence. Annu Rev Entomol. 2018;63:145–67.

    Article  CAS  PubMed  Google Scholar 

  24. Hillyer JF, Estévez-Lao TY. Nitric oxide is an essential component of the hemocyte-mediated mosquito immune response against bacteria. Dev Comp Immunol. 2010;34:141–9.

    Article  CAS  PubMed  Google Scholar 

  25. Bevivino G, Arcà B, Lombardo F. Effects of local and systemic immune challenges on the expression of selected salivary genes in the malaria mosquito Anopheles coluzzii. Pathogens. 2021;10:1300.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  26. Amcheslavsky A, Ip YT. Be a good neighbor: organ-to-organ communication during the innate immune response. Cell Host Microbe. 2012;11:323–4.

    Article  CAS  PubMed  Google Scholar 

  27. Barletta ABF, Alves LR, Nascimento Silva MCL, Sim S, Dimopoulos G, Liechocki S, et al. Emerging role of lipid droplets in Aedes aegypti immune response against bacteria and Dengue virus. Sci Rep. 2016;6:19928.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  28. Kumar V, Garg S, Gupta L, Gupta K, Diagne CT, Missé D, et al. Delineating the role of Aedes aegypti ABC transporter gene family during mosquito development and arboviral infection via transcriptome analyses. Pathogens. 2021;10:1127.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  29. Croker B, Crozat K, Berger M, Xia Y, Sovath S, Schaffer L, et al. ATP-sensitive potassium channels mediate survival during infection in mammals and insects. Nat Genet. 2007;39:1453–60. https://doiorg.publicaciones.saludcastillayleon.es/10.1038/ng.2007.25.

    Article  CAS  PubMed  Google Scholar 

  30. Figueira-Mansur J, Ferreira-Pereira A, Mansur JF, Franco TA, Alvarenga ESL, Sorgine MHF, et al. Silencing of P-glycoprotein increases mortality in temephos-treated Aedes aegypti larvae. Insect Mol Biol. 2013;22:648–58. https://doiorg.publicaciones.saludcastillayleon.es/10.1111/imb.12052.

    Article  CAS  PubMed  Google Scholar 

  31. Epis S, Porretta D, Mastrantonio V, Comandatore F, Sassera D, Rossi P, et al. ABC transporters are involved in defense against permethrin insecticide in the malaria vector Anopheles stephensi. Parasites Vectors. 2014;7:1.

    Article  Google Scholar 

  32. Mastrantonio V, Ferrari M, Epis S, Negri A, Scuccimarra G, Montagna M, et al. Gene expression modulation of ABC transporter genes in response to permethrin in adults of the mosquito malaria vector Anopheles stephensi. Acta Trop. 2017;171:37–43.

    Article  CAS  PubMed  Google Scholar 

  33. Rees DC, Johnson E, Lewinson O. ABC transporters: the power to change. Nat Rev Mol Cell Biol. 2009;10:218–27. https://doiorg.publicaciones.saludcastillayleon.es/10.1038/nrm2646.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  34. Wilkens S. Structure and mechanism of ABC transporters. F1000Prime Rep. 2015;7:14. https://doiorg.publicaciones.saludcastillayleon.es/10.12703/P7-14.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  35. Hollenstein K, Dawson RJ, Locher KP. Structure and mechanism of ABC transporter proteins. Curr Opin Struct Biol. 2007;17:412–8. https://doiorg.publicaciones.saludcastillayleon.es/10.1016/j.sbi.2007.07.003.

    Article  CAS  PubMed  Google Scholar 

  36. Gupta K, Dhawan R, Kajla M, Kumar S, Jnanasiddhy B, Singh NK, et al. Molecular identification of Aedes aegypti mosquitoes from Pilani region of Rajasthan, India. J Vector Borne Dis. 2016;53:149–55.

    Article  CAS  PubMed  Google Scholar 

  37. Molina-Cruz A, Gupta L, Richardson J, Bennett K, Black W IV, Barillas-Mury C. Effect of mosquito midgut trypsin activity on dengue-2 virus infection and dissemination in Aedes aegypti. Am J Trop Med Hyg. 2005;72:631–7.

    Article  PubMed  Google Scholar 

  38. Gupta L, Molina-Cruz A, Kumar S, Rodrigues J, Dixit R, Zamora RE, et al. The STAT pathway mediates late-phase immunity against Plasmodium in the mosquito Anopheles gambiae. Cell Host Microbe. 2009;5:498–507.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  39. Kumar S, Gupta L, Han YS, Barillas-Mury C. Inducible peroxidases mediate nitration of Anopheles midgut cells undergoing apoptosis in response to Plasmodium invasion. J Biol Chem. 2004;279:53475–82.

    Article  CAS  PubMed  Google Scholar 

  40. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2-ΔΔCT method. Methods. 2001;25:402–8.

    Article  CAS  PubMed  Google Scholar 

  41. Sanders HR, Evans AM, Ross LS, Gill SS. Blood meal induces global changes in midgut gene expression in the disease vector, Aedes aegypti. Insect Biochem Mol Biol. 2003;33:1105–22.

    Article  CAS  PubMed  Google Scholar 

  42. Hillyer JF, Schmidt SL, Christensen BM. The antibacterial innate immune response by the mosquito Aedes aegypti is mediated by hemocytes and independent of Gram type and pathogenicity. Microbes Infect. 2004;6:448–59.

    Article  CAS  PubMed  Google Scholar 

  43. Matthews BJ, McBride CS, DeGennaro M, Despo O, Vosshall LB. The neurotranscriptome of the Aedes aegypti mosquito. BMC Genomics. 2016;17:32.

    Article  PubMed  PubMed Central  Google Scholar 

  44. Ewart GD, Howells AJ. ABC transporters involved in transport of eye pigment precursors in Drosophila melanogaster. Methods Enzymol. 1998;292:213–24.

    Article  CAS  PubMed  Google Scholar 

  45. Jiang Y, Lin X. Role of ABC transporters white, scarlet and brown in brown planthopper eye pigmentation. Comp Biochem Physiol Part B Biochem Mol Biol. 2018;221–222:1–10.

    Article  Google Scholar 

  46. Cai JA, Christophides GK. Immune interactions between mosquitoes and microbes during midgut colonization. Curr Opin Insect Sci. 2024;63:101195.

    Article  PubMed  Google Scholar 

  47. Martins NE, Faria VG, Teixeira L, Magalhães S, Sucena É. Host Adaptation Is Contingent upon the Infection Route Taken by Pathogens. PLoS Pathog. 2013;9:e1003601.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  48. Dekmak AS, Yang X, Zu Dohna H, Buchon N, Osta MA. The route of infection influences the contribution of key immunity genes to antibacterial defense in Anopheles gambiae. J Innate Immun. 2021;13:107–26.

    Article  CAS  PubMed  Google Scholar 

  49. Dong Y, Manfredini F, Dimopoulos G. Implication of the mosquito midgut microbiota in the defense against malaria parasites. PLoS Pathog. 2009;5:e1000423. https://doiorg.publicaciones.saludcastillayleon.es/10.1371/journal.ppat.1000423.

    Article  PubMed  PubMed Central  Google Scholar 

  50. Meister S, Agianian B, Turlure F, Relógio A, Morlais I, Kafatos FC, et al. Anopheles gambiae PGRPLC-mediated defense against bacteria modulates infections with malaria parasites. PLoS Pathog. 2009;5:e1000542. https://doiorg.publicaciones.saludcastillayleon.es/10.1371/journal.ppat.1000542.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  51. Mithilesh Kajla KG, Sanjeev Kumar LG. A fine-tuned management between physiology and immunity maintains the gut microbiota in insects. Biochem Physiol. 2015;4:182. https://doiorg.publicaciones.saludcastillayleon.es/10.4172/2168-9652.1000182.

    Article  CAS  Google Scholar 

  52. Kato N, Mueller CR, Fuchs JF, McElroy K, Wessely V, Higgs S, et al. Evaluation of the function of a type I peritrophic matrix as a physical barrier for midgut epithelium invasion by mosquito-borne pathogens in Aedes aegypti. Vector-Borne Zoonotic Dis. 2008;8:701–12. https://doiorg.publicaciones.saludcastillayleon.es/10.1089/vbz.2007.0270.

    Article  PubMed  PubMed Central  Google Scholar 

  53. Kumar S, Molina-Cruz A, Gupta L, Rodrigues J, Barillas-Mury C. A peroxidase/dual oxidase system modulates midgut epithelial immunity in Anopheles gambiae. Science. 2010;327:1644–8. https://doiorg.publicaciones.saludcastillayleon.es/10.1126/science.1184008.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

Download references

Acknowledgements

Department of Biotechnology (DBT), Government of India, is acknowledged for funding the original project. ICMR is acknowledged for providing a fellowship to V.K. The infrastructural and accounts support given by BITS Pilani administration is gratefully acknowledged.

Funding

Open access funding provided by Birla Institute of Technology and Science. This research was funded by the Department of Biotechnology (DBT), Government of India, grant no. BT/PR8758/AGR/36/744/2013, awarded to S.K. and L.G., V.K. received a Senior Research Fellowship (F/41/2018-ECD-II) from the Indian Council of Medical Research (ICMR), Government of India. Partial funds were supported by BITS Pilani as a Professional Funds Allowance to S.G. and V. S.

Author information

Author notes

  1. Sanjeev Kumar and Vishal Saxena have contributed equally to this work.

Authors and Affiliations

  1. Department of Biological Sciences, Birla Institute of Technology and Science (BITS), Pilani Campus, Pilani, 333031, Rajasthan, India

    Vikas Kumar, Shilpi Garg, Diksha Sisodia & Vishal Saxena

  2. Department of Zoology, Chaudhary Bansi Lal University, Bhiwani, Haryana, India

    Lalita Gupta

  3. Department of Biotechnology, Chaudhary Bansi Lal University, Bhiwani, Haryana, India

    Sanjeev Kumar

Authors
  1. Vikas Kumar
    View author publications

    You can also search for this author inPubMed Google Scholar

  2. Shilpi Garg
    View author publications

    You can also search for this author inPubMed Google Scholar

  3. Diksha Sisodia
    View author publications

    You can also search for this author inPubMed Google Scholar

  4. Lalita Gupta
    View author publications

    You can also search for this author inPubMed Google Scholar

  5. Sanjeev Kumar
    View author publications

    You can also search for this author inPubMed Google Scholar

  6. Vishal Saxena
    View author publications

    You can also search for this author inPubMed Google Scholar

Contributions

V.K.: conceptualization, investigation, formal analysis, methodology, writing—original draft, review and editing; S.G. conceptualization, resources, formal analysis, supervision, writing—review and editing; D.S. investigation, experimental setup; L.G.: conceptualization, funding acquisition, resources, writing—review and editing; S.K., V.S.: conceptualization, funding acquisition, resources, supervision, writing—review and editing.

Corresponding authors

Correspondence to Sanjeev Kumar or Vishal Saxena.

Ethics declarations

Ethics approval and consent to participate

The study was conducted according to the guidelines of the Declaration of Helsinki and approved by the Ethics Committee of the Institute Biosafety Committee (protocol code BITS/IBSC/ 2018/02, approval date: 10 March 2018 (2018–2021); Institute Animal Ethics Committee (protocol code IAEC/RES/23/18, approval date: 28 October 2017 (2017–19)) and (protocol code IAEC/RES/28/7, approval date: 10 October 2020 (2020–22)).

Competing interests

The authors declare no competing interests.

Consent for publication

All the authors have gone through the manuscript and have given due Consent to publish the data as presented in the manuscript.

Additional information

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Supplementary Information

13071_2025_6658_MOESM1_ESM.docx

Additional file 1: Table S1A. The list of primers used for gene expression profiles of Aedes aegypti ABC transporters. Table S1B. The list of primers used for gene expression profiles of Aedes aegypti immune genes.

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.

Reprints and permissions

About this article

Check for updates. Verify currency and authenticity via CrossMark

Cite this article

Kumar, V., Garg, S., Sisodia, D. et al. Midgut immune profiling and functional characterization of Aedes aegypti ABC transporter gene(s) using systemic and local bacterial challenges. Parasites Vectors 18, 34 (2025). https://doiorg.publicaciones.saludcastillayleon.es/10.1186/s13071-025-06658-6

Download citation

  • Received:

  • Accepted:

  • Published:

  • DOI: https://doiorg.publicaciones.saludcastillayleon.es/10.1186/s13071-025-06658-6

Keywords

Parasites & Vectors

ISSN: 1756-3305

Contact us